human snca  (MedChemExpress)

Journal: bioRxiv

Article Title: Neural cell state modulation by PARK2 and dopaminergic neuroprotection by small molecule Parkin agonism

doi: 10.64898/2026.04.01.715918

Figure Lengend Snippet: ( a ) Single cell sequencing results and unsupervised clustering of WT cells (Parental1, Parental2, Parental Bulk)(n=3) and KO cells (KO1, KO2)(n=2). Four primary clusters are identified that correspond to population types shown in the legend at the bottom. Colors indicate cell types. ( b ) Parkin loss alters the relative ratio of cell types following differentiation induction. Frequency of resulting cellular types from differentiation in each genotype is shown as a stacked bar plot for each sample. ( c ) Parkin KO results in alterations in transcription factors related to neuronal cell state. DecoupleR analysis was performed on differentially expressed genes between WT and KO neuronal-like cells. DecoupleR TF scores are plotted for each genotype. ( d ) Examples of Parkin KO-induced alterations in the expression of genes important for each cell type. Differential expression was performed to identify the top and bottom 5 genes by log2FC. Data shown as dot plots with the size of each dot representing the cell percentage expressing the gene, and the color scale indicating the average normalized expression level. ( e ) GSEA analysis of differentially expressed genes between KO neuronal cells and WT neuronal cells (x-axis represents the normalized enrichment score; dot size shows the gene set size; color shows p-value). ( f ) Genes from the gene ontology set Ribosome Assembly were selected, and the Log2FC is shown for KO vs WT cells as shown. Each row represents the KO vs WT comparison for the indicated cell type. ( g ) Chemical Structure of compound FB231. ( h ) Concentration of FB231 in the plasma of rats with IV and IP administration. Rats were treated with intravenous injection (1 mg/kg) and i.p. injection (3 mg/kg). ( i ) Immunoprecipitation (IP) of Parkin constructs. T98G cells were transfected with either pcDNA3.1 empty vector (EV) or with vector encoding WT Parkin. Cell lysates were prepared and immunoprecipitated with anti-Parkin antibody. ( j ) FB231 promotes Parkin activity to ubiquitinate cyclin D in vitro. Using Parkin IP, in vitro ubiquitination assay was performed. Different concentrations of compound FB231 were added in the indicated reactions. ( k ) Compound FB231 promotes Parkin activity to ubiquitinate αSyn in vitro. Using the above Parkin-pulled-down solution , an in vitro ubiquitination assay was performed, followed by a Western blot. Different concentrations of compound FB231 were added as indicated.

Article Snippet: Finally, αSyn primers (Origene, HP200326) had the following sequence for forward and reverse primers, respectively: ACCAAACAGGGTGTGGCAGAAG and CTTGCTCTTTGGTCTTCTCAGCC.

Techniques: Single Cell, Sequencing, Expressing, Quantitative Proteomics, Comparison, Concentration Assay, Clinical Proteomics, Injection, Immunoprecipitation, Construct, Transfection, Plasmid Preparation, Activity Assay, In Vitro, Ubiquitin Proteomics, Western Blot

Journal: IBRO Neuroscience Reports

Article Title: Trimethylamine-N-oxide damages astrocytes and lymphatic endothelial cells in the cerebral lymphatic system

doi: 10.1016/j.ibneur.2025.09.001

Figure Lengend Snippet: Effects of TMAO on intracranial inflammation and functional proteins in animals. Levels of IL-6, NLRP3, TNF-α, and SNCA in the cerebrospinal fluid detected by ELISA. (B) The injury of ventral midbrain neurons detected by Nissl staining. (C) Immunofluorescence was used to detect the effects of TMAO on AQP4, GFAP, S100, claudin-5, and Ocln in the ventral midbrain of mice. Three animals were randomly selected from each group (n = 10) for sample testing, analysis of variance followed by LSD or Dunnett's post-hoc test was used to compare between-group differences. 'ns' indicates that there was no significant difference between the groups.

Article Snippet: After TMAO administration, mice were anesthetized with ketamine at a dose of 100 mg/kg by intraperitoneal injection, then stereotactically injected with 2.5 μL (concentration 3 μg/mL) recombinant human SNCA protein (PRS-pro-393, Amyjet Scientific Technology Co., Ltd, Hubei, China) intracranially at a rate of 0.25 μL/min.

Techniques: Functional Assay, Enzyme-linked Immunosorbent Assay, Staining, Immunofluorescence

Journal: bioRxiv

Article Title: Intracellular delivery of full-length antibodies via organ targeted lipid nanoparticles

doi: 10.1101/2025.09.26.678781

Figure Lengend Snippet: (a) Schematic depicting intracranial (i.c.) administration of Cy5-SynO4-SL4-LNPs into the substantia nigra (SN). (b) Representative images of coronal brain tissue sections from the SN region imaged 72 hours after i.c. injection. Sections were fixed and immunostained for tyrosine hydroxylase (TH, dopamine neurons, red), human phosphorylated alpha synuclein (pAS, green), and counterstained with DAPI for cell nuclei (blue). Scale bar = 5 mm. (c) Representative images of brain tissue sections fixed and immunostained for tyrosine hydroxylase (TH, dopamine neurons, red), human phosphorylated alpha synuclein (pAS, green), and counterstained with DAPI for cell nuclei (blue). Colocalization images indicates target engagement of Cy5-SynO4 (purple) with pAS (green). Scale bar = 20 µm. (d) Schematic depicting procedure for formulating transferrin-targeted LNPs (TF-Cy5-SynO4-SL4 LNPs) via microfluidic mixing. (e) Schematic depicting intravenous (i.v.) administration of TF-Cy5-SynO4-SL4 LNPs. (f) Representative images of control brain (non-injected) sections and treated brain sections 6 hours after i.v. injections. Tissue sections were fixed and immunostained for TH (dopamine neurons, red), pAS (green), and counterstained with DAPI for cell nuclei (blue). Cy5-SynO4 antibodies are indicated where they localized and co-localized with pAS in the SN. Scale bar = 50 µm. Results obtained from n = 3 independent repetitions ( n = 9 replicates each).

Article Snippet: An in-house ELISA assay using the direct ELISA method was used for the Anti-Human SNCA Therapeutic (SynO4) Antibody (TAB-0750CLV-L; Creative Biolabs, USA).

Techniques: Injection, Drug discovery, Control